Inerting sequences with miniMos is relatively efficient, but requires performing inverse PCR to identify the insertion site. And often, the insertion site is not ideal (such as being in the middle of a coding gene). On the other hand, since one is screening for the insertions by expression of a sqt-1 marker, one knows the site is at least permissive for expression.
Plasmid Reagents
miniMos landing site vectors
pCFJ1272 FRT FRT3 landing [map] [sequence] [addgene]
pCFJ1272 mex-5 FLP FRT FRT3 landing [map] [sequence] [addgene]
other plasmid reagents
pCFJ601 elf-3p Mos1 transposase [addgene]
pGH8 rab-3p mCherry [addgene]
pCFJ90 myo-2p mCherry [addgene]
Protocol
Isolation of miniMos insertions
A mixture of a miniMos plasmid (10-25 ng/µl), pCFJ601 (50 ng/µl), pGH8 (2 ng/µl) and pCFJ90 (4 ng/µl) is injected into N2 animals using standard C. elegans germline microinjection techniques. F1 Rol progeny are picked and pooled at 5 – 6 per plate. F1 plates are screened for F2 Rol animals that do not express detectable levels of mCherry in the pharynx or nervous system on an epi-fluorescence dissecting microscope, and these are cloned. F2 Rol animals which segregated Rol progeny in a 3:1 Mendelian ratio are analyzed further. F3 animals that segregated 100% Rol are examined for appropriate fluorescence expression and complete absence of detectable pharyngeal muscle or neuronal mCherry expression and analyzed using inverse PCR to determine the position of miniMos insertion(s). The insertion is then heat shocked to excise the SEC. 12-15 young L1/l2 animals are heat shocked at 34°C for 4 hours, or 37°C for 40 minutes, and the progeny are screened for non-Rol animals. Two-component insertions are outcrossed to bqSi711 and single component insertions are outcrossed to N2.
Preparation of genomic DNA
Worms are collected from a single recently starved 60 mm plate and frozen in 50 µl of water. The worm pellet is thawed, and 150 µl of 2 mM EDTA, 10 mM Tris 7.5, 0.5% SDS, 100 µg/ml Proteinase K is added and the worms are lysed for 1 hr at 60°C with occasional mixing. To remove RNA, 2 µl of 10 mg/ml RNase A is added, and the tube is incubated for 30 min at 37°C. However, removal of RNA is not necessary for either long-range PCR or inverse PCR. 200 µl of 3 M Guanidine HCl, 3.75 M NH4Ac, pH 6 is added. The solution becomes cloudy after mixing. 200 µl of 96% ethanol are added which clears the solution which is then loaded on a Qiagen QIAquick (PCR purification) column, washed two times with 600 µl of PE buffer (10 mM Tris-HCl pH 7.5, 80% ethanol), and eluted with 100-200 µl of TE. Yields are typically ~ 1 µg of genomic DNA.
Inverse PCR of miniMos insertions
15 ng of genomic DNA is digested with Sau3A or HpaII in a 10 µl reaction for 90 min and heat inactivated at 80°C for 20 min. The inactivated digestion is diluted with 40 µl of 1X T4 DNA ligase buffer and 0.16 µl of T4 DNA ligase is added, and incubated at 16°C for 1 hr. Circular products are amplified using two rounds of PCR. In the first round, 2 µl of the ligation is amplified in a 15 µl reaction using NMo5078/5085 and cycling conditions: 0:30 @ 98°C, 30 X [0:10 @ 98°C,0:30 @ 64°C ,1:00 @ 72°C]. One µl of a 1:100 dilution of the first PCR is used in a second 20 µl PCR using NMo5079/5080 and cycling conditions: 0:30 @ 98°C, 30 X [0:10 @ 98°C, 0:30 @ 62°C ,1:00 @ 72°C]. One µl of the second PCR is examined by gel electrophoresis. Unique products are directly purified using QiaQUICK column purification. When multiple products are present, the entire PCR reaction is loaded on an agarose gel, and single bands are excised and purified. Products are sequenced using NMo5080. Oligonucleotides: NMo5078 5′ ggtggttcgacagtcaaggt NMo5079 5′ agagcaaacgcggacagtat NMo5080 5′ cgataaatatttacgtttgcgagac NMo5085 5′ atagtttggcgcgaattgag